Vzorové otázky z biologie a chemie (přijímací zkouška)

Biologie

  1. Buněčný cyklus může být stimulován:
    1. nahromaděním odpadních látek
    2. účinkem cytostatik
    3. účinkem některých hormonů
    4. nedostatkem živin
  2. Proměnu dokonalou mají:
    1. Stejnokřídlí
    2. Ploštice
    3. Vši
    4. dvoukřídlí
  3. Gen je tvořen následujícím pořadím (sekvencí) nukleotidů: AATACCTGACGGGATGGAAAATAT
        Třetí kodon v molekule mRNA odvozený z genu je tvořen nukleotidy? ........ACU
  4. Na rozdíl od mitózy se při prvním meiotickém dělení rozcházejí:
    1. homologní chromatidy
    2. heterologní chromatidy
    3. celé homologní chromozomy
  5. Komáři:
    1. mají dokonalou proměnu
    2. mají nedokonalou proměnu
    3. patří do řádu blanokřídlého hmyzu
  6. Gen je tvořen následujícím pořadím (sekvencí) nukleotidů: AATACATGACGGGATGGA
        Kolik aminokyselin je kódováno tímto genem v polypeptidickém řetězci?....6

Chemie

  1. Kolik gramů síranu draselného bude obsahovat 135 ml jeho roztoku o koncentraci 0,5 mol/l ? [síran draselný Mr = 174,2] 

    K2SO4  - 11, 76 g

2. Vyčíslete oxidačně redukční rovnici: 4NH3 + 5O2 → 4NO + 6H2O

3. Napište reakci alkalické hydrolýzy methylchloridu hydroxidem sodným:

    CH3Cl + NaOH → CH3OH + NaCl

4. Napište vzorce následujících sloučenin:
kyselina trihydrogenboritá .............. H3BO3
jodid cesný...................................... CsI
síran železitý....................................Fe2 (SO4)3
hydrogenfosforečnanhlinitý............. Al2 (HPO4)3
sulfid antimonitý............................. .Sb2S3
chlorid-oxid bismutitý...................... BiOCl

5. Vypočtěte, kolik gramů železa je třeba k vytěsnění 10 g mědi z roztoku síranu meďnatého [Fe Ar = 56; Cu Ar = 64]:
    CuSO4 + Fe → Fe SO4 + Cu   8,75 g

6. Jaká bude látková koncentrace roztoku HCl, který vznikne smísením 500 ml roztoku o koncentraci c = 0,5 mol/l s 500 ml roztoku HCl o koncentraci c = 0,05 mol/l:
     0,275 mol/l



Perfektní zázemí

Rádi se bavíte a sportujete? V areálu univerzity se nachází největší krytá sportovní plocha ve městě, kde si studenti můžou zahrát přes 30 druhů sportu, od volejbalu, basketbalu, zumby až po fitness. Čekání na výuku si můžete zkrátit v pěkném a zeleném parku, kde je připojení na wifi. V areálu univerzity je k dispozici také Ústřední knihovna, kde můžete najít studovnu s možností zapůjčení odborné literatury z oboru veterinární medicíny, hygieny a technologie potravin či welfare zvířat, jsou zde také počítačové učebny s připojením na internet. Dále studenti mohou využít soukromé místnosti na učení nebo relax zónu. Studenti fakulty jsou podle možností univerzity ubytováni na vysokoškolských Kaunicových kolejích, kde je možnost stravování. Během roku se pořádají různé akce pro studenty jako je Vítání prváků, Univerzitní Majáles, Job fair a spoustu dalšího.

Více zde

Uplatnění absolventů

Chcete se stát odborníky v oblasti veterinární hygieny, bezpečnosti a zdravotní nezávadnosti potravin a veterinární medicíny? Máte zájem o ekologii, welfare a ochranu zvířat? Nebo se chcete podívat pod pokličku gastronomie v našem nejmladším studijním programu Zdravotní nezávadnost a bezpečnost potravin v gastronomii? Více informací o studiua

jak se můžete uplatnit najdete ZDE

TEXT