Vzorové otázky z biologie a chemie (přijímací zkouška)

Biologie

  1. Buněčný cyklus může být stimulován:
    1. nahromaděním odpadních látek
    2. účinkem cytostatik
    3. účinkem některých hormonů
    4. nedostatkem živin
  2. Proměnu dokonalou mají:
    1. Stejnokřídlí
    2. Ploštice
    3. Vši
    4. dvoukřídlí
  3. Gen je tvořen následujícím pořadím (sekvencí) nukleotidů: AATACCTGACGGGATGGAAAATAT
        Třetí kodon v molekule mRNA odvozený z genu je tvořen nukleotidy? ........ACU
  4. Na rozdíl od mitózy se při prvním meiotickém dělení rozcházejí:
    1. homologní chromatidy
    2. heterologní chromatidy
    3. celé homologní chromozomy
  5. Komáři:
    1. mají dokonalou proměnu
    2. mají nedokonalou proměnu
    3. patří do řádu blanokřídlého hmyzu
  6. Gen je tvořen následujícím pořadím (sekvencí) nukleotidů: AATACATGACGGGATGGA
        Kolik aminokyselin je kódováno tímto genem v polypeptidickém řetězci?....6

Chemie

  1. Kolik gramů síranu draselného bude obsahovat 135 ml jeho roztoku o koncentraci 0,5 mol/l ? [síran draselný Mr = 174,2] 

    K2SO4  - 11, 76 g

2. Vyčíslete oxidačně redukční rovnici: 4NH3 + 5O2 → 4NO + 6H2O

3. Napište reakci alkalické hydrolýzy methylchloridu hydroxidem sodným:

    CH3Cl + NaOH → CH3OH + NaCl

4. Napište vzorce následujících sloučenin:
kyselina trihydrogenboritá .............. H3BO3
jodid cesný...................................... CsI
síran železitý....................................Fe2 (SO4)3
hydrogenfosforečnanhlinitý............. Al2 (HPO4)3
sulfid antimonitý............................. .Sb2S3
chlorid-oxid bismutitý...................... BiOCl

5. Vypočtěte, kolik gramů železa je třeba k vytěsnění 10 g mědi z roztoku síranu meďnatého [Fe Ar = 56; Cu Ar = 64]:
    CuSO4 + Fe → Fe SO4 + Cu   8,75 g

6. Jaká bude látková koncentrace roztoku HCl, který vznikne smísením 500 ml roztoku o koncentraci c = 0,5 mol/l s 500 ml roztoku HCl o koncentraci c = 0,05 mol/l:
     0,275 mol/l



Proč studovat na VETUNI

Pro Brno tehdy rozhodla jeho centrální poloha v nově vzniklém státě a také snaha přispět k počeštění města. Brno tak získalo po České technice založené v roce 1899 svou druhou univerzitu.

Více zde

Uplatnění absolventů

Pro Brno tehdy rozhodla jeho centrální poloha v nově vzniklém státě a také snaha přispět k počeštění města. Brno tak získalo po České technice založené v roce 1899 svou druhou univerzitu.

Více zde

Prtnerské školy

Pro Brno tehdy rozhodla jeho centrální poloha v nově vzniklém státě a také snaha přispět k počeštění města. Brno tak získalo po České technice založené v roce 1899 svou druhou univerzitu.

Více zde

TEXT