Vzorové otázky z biologie a chemie (přijímací zkouška)

Magisterský studijní program pro obor Veterinární hygiena a ekologie

Fakulta veterinární hygieny a ekologie vydala pro uchazeče na FVHE brožuru „Vzorové otázky z biologie a chemie pro přijímací zkoušky

 

kompletní brožura ke stažení zde !!!


 

Biologie

1. Buněčný cyklus může být stimulován:
    a) nahromaděním odpadních látek
    b) účinkem cytostatik
    c) účinkem některých hormonů
    d) nedostatkem živin

2. Proměnu dokonalou mají:
    a) stejnokřídlí
    b) ploštice
    c) vši
    d) dvoukřídlí

3. Gen je tvořen následujícím pořadím (sekvencí) nukleotidů: AATACCTGACGGGATGGAAAATAT
    Třetí kodon v molekule mRNA odvozený z genu je tvořen nukleotidy? ........ACU

4. Na rozdíl od mitózy se při prvním meiotickém dělení rozcházejí:
    a) homologní chromatidy
    b) heterologní chromatidy
    c) celé homologní chromozomy

5. Komáři:
    a) mají dokonalou proměnu
    b) mají nedokonalou proměnu
    c) patří do řádu blanokřídlého hmyzu

6. Gen je tvořen následujícím pořadím (sekvencí) nukleotidů: AATACATGACGGGATGGA
    Kolik aminokyselin je kódováno tímto genem v polypeptidickém řetězci?....6

 
 
Chemie

1. Kolik gramů síranu draselného bude obsahovat 135 ml jeho roztoku o koncentraci 0,5 mol/l ? [síran draselný Mr = 174,2]  
    K2SO4  - 11, 76 g


2. Vyčíslete oxidačně redukční rovnici: 4NH3 + 5O2 → 4NO + 6H2O

3. Napište reakci alkalické hydrolýzy methylchloridu hydroxidem sodným:
    CH3Cl + NaOH → CH3OH + NaCl

4. Napište vzorce následujících sloučenin:
    kyselina trihydrogenboritá .............. H3BO3
    jodid cesný...................................... CsI
    síran železitý....................................Fe2 (SO4)3
    hydrogenfosforečnanhlinitý............. Al2 (HPO4)3
    sulfid antimonitý............................. .Sb2S3
    chlorid-oxid bismutitý...................... BiOCl

5. Vypočtěte, kolik gramů železa je třeba k vytěsnění 10 g mědi z roztoku síranu meďnatého [Fe Ar = 56; Cu Ar = 64]:
    CuSO4 + Fe → Fe SO4 + Cu   8,75 g

6. Jaká bude látková koncentrace roztoku HCl, který vznikne smísením 500 ml roztoku o koncentraci c = 0,5 mol/l s 500 ml roztoku HCl o koncentraci c = 0,05 mol/l:
     0,275 mol/l


Pozn.: správné odpovědi jsou vyznačeny tučně.